The Nudeotide Sequences of Two Trna Genes from Tobacco Chloroplasts
نویسنده
چکیده
Recombinant plasmids which contain EcoRI fragments of tobacco chloroplast DNA carrying tRNA genes were constructed. Plasmids pTC211 and pTC293 contain the base sequences for tRNA in their 1.4 and 1.1 Md EcoRI fragments, respectively. These two tRNA sequences are identical and are; 5'-TCCTCAGTAGCT CAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGTAGGTTCGAATCCTACTTGGGGAG-3. Each tRNA gene is located at about 0.9 kb apart from the distal end of each 5S rRNA gene and is coded for by the DNA strand opposite from that of the rRNA genes.
منابع مشابه
Identified Hybrid tRNA Structure Genes in Archaeal Genome
Background: In Archaea, previous studies have revealed the presence of multiple intron-containing tRNAs and split tRNAs. The full unexpurgated analysis of archaeal tRNA genes remains a challenging task in the field of bioinformatics, because of the presence of various types of hidden tRNA genes in archaea. Here, we suggested a computational method that searched for widely separ...
متن کاملNucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC): the tRNAVal (UAC) gene contains a long intron.
The nucleotide sequences of tobacco chloroplast genes for elongator tRNAMet and tRNAVal (UAC) have been determined. The tRNAVal gene contains a 571 base pairs intron located in the anticodon loop. The tRNAVal gene is transcribed as a 750 bases precursor RNA molecule. Both tRNAs deduced from the DNA sequences show 97% sequence homologies with those of spinach chloroplasts.
متن کاملCodon optimization and cloning of bovine prochymosin gene for proper expression in tobacco plant
Bovine chymosin enzyme is one of the most commonly used enzymes in the dairy industry. The production of this enzyme from its natural source does not meet the needs of this huge industry. The production of recombinant bovine chymosin in plants can be a good alternative to native enzyme. Insertion and expression of foreign genes in plants can occur in the nucleus and chloroplast organelles. The ...
متن کاملARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences.
A computer program, ARAGORN, identifies tRNA and tmRNA genes. The program employs heuristic algorithms to predict tRNA secondary structure, based on homology with recognized tRNA consensus sequences and ability to form a base-paired cloverleaf. tmRNA genes are identified using a modified version of the BRUCE program. ARAGORN achieves a detection sensitivity of 99% from a set of 1290 eubacterial...
متن کاملNucleotide sequences of two glutamine tRNAs from HeLa cells.
We reported previously that 4.5S RNAj, is associated with poly A RNAs of rodent cells (1). However, this molecule was not found in human, monkey, cat, mink, rabbit or chicken cells ^1) . In HeLa cells, several 4S RNAs are released from the poly A RNA fraction (1) . We determined the nudeotide sequence of one of the most abundant 4S RNA species in this fraction. Nudeotide sequence analysis was p...
متن کامل